cell lines iat2 type 2 pneumocytes crem (ATCC)

ATCC cell lines iat2 type 2 pneumocytes crem

Figure 1. Phospho/Proteomic Proﬁling of Human iAT2s after SARS-CoV-2 Infection (A) (Top) Schematic of 3D alveolospheres and <t>iAT2</t> ALI cultures. Apical media was removed for 7 days before infection with SARS-CoV-2; DE, deﬁnitive endoderm; AFE, anterior foregut endoderm. Representative confocal IFA images (103) of iAT2s expressing tdTomato from endogenous SFTPC locus. (Bottom) iAT2 ALI cultures were infected with SARS-CoV-2 (MOI = 5) for indicated times with parallel mock-treated controls. Representative staining (203) of DNA (Hoechst, blue) and viral N (green) indicating infection. (B) Total protein from replicate SARS-CoV-2-infected and mock-treated iAT2s was analyzed by quantitative LC-MS/MS. (C) Replicate measurements were normalized and ﬁltered (<1% FDR), resulting in high reproducibility (r = PCC). Venn diagram shows number of identiﬁed cellular/ viral proteins/phosphosites subject to downstream analysis.

Cell Lines Iat2 Type 2 Pneumocytes Crem, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cell+lines+iat2+type+2+pneumocytes+crem/Vero/pm33259812-482-130-142
Average 99 stars, based on 1 article reviews

cell lines iat2 type 2 pneumocytes crem - by Bioz Stars, 2026-09

99/100 stars

Buy from Supplier

vero c1008 (ATCC)

ATCC vero c1008

Vero C1008, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cell+lines+iat2+type+2+pneumocytes+crem/VERO+C1008/custom%40crl-1586%4033259812
Average 99 stars, based on 1 article reviews

vero c1008 - by Bioz Stars, 2026-09

99/100 stars

Buy from Supplier

Image Search Results

Figure 1. Phospho/Proteomic Proﬁling of Human iAT2s after SARS-CoV-2 Infection (A) (Top) Schematic of 3D alveolospheres and iAT2 ALI cultures. Apical media was removed for 7 days before infection with SARS-CoV-2; DE, deﬁnitive endoderm; AFE, anterior foregut endoderm. Representative confocal IFA images (103) of iAT2s expressing tdTomato from endogenous SFTPC locus. (Bottom) iAT2 ALI cultures were infected with SARS-CoV-2 (MOI = 5) for indicated times with parallel mock-treated controls. Representative staining (203) of DNA (Hoechst, blue) and viral N (green) indicating infection. (B) Total protein from replicate SARS-CoV-2-infected and mock-treated iAT2s was analyzed by quantitative LC-MS/MS. (C) Replicate measurements were normalized and ﬁltered (<1% FDR), resulting in high reproducibility (r = PCC). Venn diagram shows number of identiﬁed cellular/ viral proteins/phosphosites subject to downstream analysis.

Journal: Molecular cell

Article Title: Actionable Cytopathogenic Host Responses of Human Alveolar Type 2 Cells to SARS-CoV-2.

doi: 10.1016/j.molcel.2020.11.028

Figure Lengend Snippet: Figure 1. Phospho/Proteomic Proﬁling of Human iAT2s after SARS-CoV-2 Infection (A) (Top) Schematic of 3D alveolospheres and iAT2 ALI cultures. Apical media was removed for 7 days before infection with SARS-CoV-2; DE, deﬁnitive endoderm; AFE, anterior foregut endoderm. Representative confocal IFA images (103) of iAT2s expressing tdTomato from endogenous SFTPC locus. (Bottom) iAT2 ALI cultures were infected with SARS-CoV-2 (MOI = 5) for indicated times with parallel mock-treated controls. Representative staining (203) of DNA (Hoechst, blue) and viral N (green) indicating infection. (B) Total protein from replicate SARS-CoV-2-infected and mock-treated iAT2s was analyzed by quantitative LC-MS/MS. (C) Replicate measurements were normalized and ﬁltered (<1% FDR), resulting in high reproducibility (r = PCC). Venn diagram shows number of identiﬁed cellular/ viral proteins/phosphosites subject to downstream analysis.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER danusertib Selleck S1107 dorsomorphin Selleck S7840 ellagic-acid Selleck S1327 emricasan Selleck S7775 FRAX486 Selleck S7807 KN-93 Selleck S7423 levofloxacin Selleck S1940 losmapimod Selleck S7215 NVP-BEZ235 Selleck S1009 PCI-27483 Cayman 21334 PFI-3 Selleck S7315 RK-33 Selleck S8246 Roflumilast Selleck S2131 SB-415286 Selleck S2729 sirolimus Selleck S1039 SRPIN340 Selleck S7270 teriflunomide Selleck S4169 TG-003 Selleck S7320 TIC10 Selleck S7963 tideglusib Selleck S2823 tubercidin Selleck S8095 vandetanib Selleck S1046 VE-822 Selleck S7102 volasertib Selleck S2235 Critical Commercial Assays Pierce Quantitative Colorimetric Peptide Assay Thermo 23275 Deposited Data Raw MS/MS data and search results This Paper ProteomeXchange - PRIDE: PXD020183 Human Proteome, all canonical reviewed sequences Swiss-Prot, uniprot.org Downloaded 2020-02-10 SARS-CoV-2 Proteome, all Swiss-Prot and TrEMBL sequences Uniprot.org Downloaded 2020-05-03 Imaging and processed data This Paper https://doi.org/10.17632/vhm7zh5ssp.2 Experimental Models: Cell Lines iAT2 Type 2 Pneumocytes CReM, Boston University SPC2-ST-B2 Vero E6 ATCC CRL-1586 Oligonucleotides CCNL_F_1 IDT TGAACGTAATCAAACCCTGGTTCA CCNL-Int_R_3 IDT CCTCTGCACTTCAGCCCATG CCNL1_R_2 IDT TTGCATCTACCTTGCAGCTAGAGC DOCK4_F_1 IDT TCCTCCTCACTGTCCTCACAAGC DOCK4_int_R_3 IDT AAAGCCTAGGCACGCTGCAC DOCK4_R_2 IDT TCACTCGGCTTCACCTAATGTGA FERMT3_F_1 IDT ATCTACCTGCGGTGCCAGGA FERMT3_R_2 IDT TCCAGCGAAAGTTCAAGGCC RBM5_F_1 IDT TAAGCCGTGGTTTCGCCTTC RBM5_R_2 IDT TGGTGATTCAAGGAAAGCACATTG NPR2_F_1 IDT GGCATGGCCTTTCTCCACAA NPR2_R_2 IDT GAACCCCTTGCCAACCACAG (Continued on next page) ll Resource e2 Molecular Cell 80, 1104–1122.e1–e9, December 17, 2020

Techniques: Infection, Expressing, Staining, Liquid Chromatography with Mass Spectroscopy

Figure 3. Phosphoproteomic Proﬁling Reveals Dysregulated Pathways (A) Bar-plot of differential phosphosites (1–6 hpi). (B) Domain structure of SARS-CoV-2 N (top) and M (bottom) showing identiﬁed phosphosites. (C) Structural models of phospho-CNSKA2 (S197) complexed with viral N (S79). (D) Clustering of phosphosite abundance changes. (E) Enriched pathways and processes. (F) Up- or downregulated kinases (KSEA). (G) IFA of phosphogamma-H2AX (green) and viral N (red) in infected versus mock-treated iAT2 (DAPI counterstain). Greyscale images show exclusively phospho- g-H2AX localization in iAT2s (number foci per nucleus shown at right, p value < 0.05, Wilcoxon rank-sum test).

Journal: Molecular cell

Article Title: Actionable Cytopathogenic Host Responses of Human Alveolar Type 2 Cells to SARS-CoV-2.

doi: 10.1016/j.molcel.2020.11.028

Figure Lengend Snippet: Figure 3. Phosphoproteomic Proﬁling Reveals Dysregulated Pathways (A) Bar-plot of differential phosphosites (1–6 hpi). (B) Domain structure of SARS-CoV-2 N (top) and M (bottom) showing identiﬁed phosphosites. (C) Structural models of phospho-CNSKA2 (S197) complexed with viral N (S79). (D) Clustering of phosphosite abundance changes. (E) Enriched pathways and processes. (F) Up- or downregulated kinases (KSEA). (G) IFA of phosphogamma-H2AX (green) and viral N (red) in infected versus mock-treated iAT2 (DAPI counterstain). Greyscale images show exclusively phospho- g-H2AX localization in iAT2s (number foci per nucleus shown at right, p value < 0.05, Wilcoxon rank-sum test).

Techniques: Phospho-proteomics, Infection

Figure 4. Validation Analyses (A) Immunoblotting of lysates from mock and SARS-CoV-2-infected iAT2 ALI at 24 hpi. Probes indicated (beta-actin loading control). (B) (Left) Hyperphosphorylation of SRSF proteins 24 hpi. (Right) Position and relative change in phosphosites. (C) 3D model of hyperphosphorylated sites (S199/S197/S204/S211) on SRSF9 in infected iAT2s relative to controls. (D) Schematic of splicing events impacted by infection. (E) Analyses of RNA-seq data (Huang et al., 2020) showing virus-induced splicing alterations. (F) Functional annotations of differential spliced gene products. (G) Ratio of spliced to unspliced transcripts for select mRNAs in mock or infected iAT2s. For CLK1, ratio of splicing with/without exon 4 (E4) inclusion shown. Bars represent mean (±SD) from 3 biological replicates; *p < 0.1; **p < 0.01; ***p < 0.001, t test. (H) EM images of nuclear envelope (white arrows), ER (red; double-points indicate extended ER), ribosomes (yellow), and nucleus (N) in mock and infected iAT2s (scale bar = 500 nm; insets magniﬁed 43). (I) IFA (403) and quantiﬁcation (±SD) of g-tubulin (594 nm) and viral N (488 nm) in control and infected iAT2s (counterstained with DAPI). Scale bar = 10 mm.

Journal: Molecular cell

Article Title: Actionable Cytopathogenic Host Responses of Human Alveolar Type 2 Cells to SARS-CoV-2.

doi: 10.1016/j.molcel.2020.11.028

Figure Lengend Snippet: Figure 4. Validation Analyses (A) Immunoblotting of lysates from mock and SARS-CoV-2-infected iAT2 ALI at 24 hpi. Probes indicated (beta-actin loading control). (B) (Left) Hyperphosphorylation of SRSF proteins 24 hpi. (Right) Position and relative change in phosphosites. (C) 3D model of hyperphosphorylated sites (S199/S197/S204/S211) on SRSF9 in infected iAT2s relative to controls. (D) Schematic of splicing events impacted by infection. (E) Analyses of RNA-seq data (Huang et al., 2020) showing virus-induced splicing alterations. (F) Functional annotations of differential spliced gene products. (G) Ratio of spliced to unspliced transcripts for select mRNAs in mock or infected iAT2s. For CLK1, ratio of splicing with/without exon 4 (E4) inclusion shown. Bars represent mean (±SD) from 3 biological replicates; *p < 0.1; **p < 0.01; ***p < 0.001, t test. (H) EM images of nuclear envelope (white arrows), ER (red; double-points indicate extended ER), ribosomes (yellow), and nucleus (N) in mock and infected iAT2s (scale bar = 500 nm; insets magniﬁed 43). (I) IFA (403) and quantiﬁcation (±SD) of g-tubulin (594 nm) and viral N (488 nm) in control and infected iAT2s (counterstained with DAPI). Scale bar = 10 mm.

Techniques: Biomarker Discovery, Western Blot, Infection, Control, RNA Sequencing, Virus, Functional Assay

Figure 5. Time-Resolved Host Cell Responses to SARS-CoV-2 Infection (A) Enrichment map of iAT2 processes and pathways (nodes) altered by infection (red: upregulated/positive; blue: downregulated/negative), grouped and scaled according to shared (edges) and number (size) of components. Quadrants delineate the four-infection time points (1 to 24 hpi); iAT2-speciﬁc pathways are outlined in red, while black indicates conserved/generic responses. (B) Comparative analyses of SARS-CoV-2-infected iAT2s (this study), Caco-2 (Bojkova et al., 2020), A549 (Stukalov et al., 2020), and Vero E6 cells (Bouhaddou et al., 2020); positive and negative enrichment of functional annotations based on normalized enrichment scores (NES). (C) Heatmap of differential host pathways/processes common to all four infection studies.

Journal: Molecular cell

Article Title: Actionable Cytopathogenic Host Responses of Human Alveolar Type 2 Cells to SARS-CoV-2.

doi: 10.1016/j.molcel.2020.11.028

Figure Lengend Snippet: Figure 5. Time-Resolved Host Cell Responses to SARS-CoV-2 Infection (A) Enrichment map of iAT2 processes and pathways (nodes) altered by infection (red: upregulated/positive; blue: downregulated/negative), grouped and scaled according to shared (edges) and number (size) of components. Quadrants delineate the four-infection time points (1 to 24 hpi); iAT2-speciﬁc pathways are outlined in red, while black indicates conserved/generic responses. (B) Comparative analyses of SARS-CoV-2-infected iAT2s (this study), Caco-2 (Bojkova et al., 2020), A549 (Stukalov et al., 2020), and Vero E6 cells (Bouhaddou et al., 2020); positive and negative enrichment of functional annotations based on normalized enrichment scores (NES). (C) Heatmap of differential host pathways/processes common to all four infection studies.

Techniques: Infection, Functional Assay

Figure 7. Depiction of Viral Perturbations to Alveolar Type 2 Cells by SARS-CoV-2 Top: Lung pathobiology caused by SARS-CoV-2, with histologic sections of COVID-19 patient lung biopsies stained with H&E and cytokeratin AE1/AE3 showing diffuse alveolar damage, sloughed pneumocytes, and focal hyalin membrane material (2003 mag). Bottom: Viral-dysregulated iAT2 pathways, processes, proteins, phosphosites, and validated drugs/targets.

Journal: Molecular cell

Article Title: Actionable Cytopathogenic Host Responses of Human Alveolar Type 2 Cells to SARS-CoV-2.

doi: 10.1016/j.molcel.2020.11.028

Figure Lengend Snippet: Figure 7. Depiction of Viral Perturbations to Alveolar Type 2 Cells by SARS-CoV-2 Top: Lung pathobiology caused by SARS-CoV-2, with histologic sections of COVID-19 patient lung biopsies stained with H&E and cytokeratin AE1/AE3 showing diffuse alveolar damage, sloughed pneumocytes, and focal hyalin membrane material (2003 mag). Bottom: Viral-dysregulated iAT2 pathways, processes, proteins, phosphosites, and validated drugs/targets.

Techniques: Staining, Membrane

cell lines iat2 type 2 pneumocytes crem Search Results

Image Search Results